ID: 1170022547

View in Genome Browser
Species Human (GRCh38)
Location 20:11852261-11852283
Sequence CACCTCCAGTTTCCAACCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170022547_1170022557 14 Left 1170022547 20:11852261-11852283 CCACAGGTTGGAAACTGGAGGTG No data
Right 1170022557 20:11852298-11852320 TCTTCATTATATGGCTCATAAGG No data
1170022547_1170022551 5 Left 1170022547 20:11852261-11852283 CCACAGGTTGGAAACTGGAGGTG No data
Right 1170022551 20:11852289-11852311 TCCCCCCTATCTTCATTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170022547 Original CRISPR CACCTCCAGTTTCCAACCTG TGG (reversed) Intergenic
No off target data available for this crispr