ID: 1170033668

View in Genome Browser
Species Human (GRCh38)
Location 20:11968215-11968237
Sequence CCAGTTCTTCCTCACTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170033668_1170033674 -9 Left 1170033668 20:11968215-11968237 CCCCAACAGTGAGGAAGAACTGG No data
Right 1170033674 20:11968229-11968251 AAGAACTGGAGACCCTGGTTGGG No data
1170033668_1170033673 -10 Left 1170033668 20:11968215-11968237 CCCCAACAGTGAGGAAGAACTGG No data
Right 1170033673 20:11968228-11968250 GAAGAACTGGAGACCCTGGTTGG No data
1170033668_1170033676 -5 Left 1170033668 20:11968215-11968237 CCCCAACAGTGAGGAAGAACTGG No data
Right 1170033676 20:11968233-11968255 ACTGGAGACCCTGGTTGGGGAGG No data
1170033668_1170033677 -4 Left 1170033668 20:11968215-11968237 CCCCAACAGTGAGGAAGAACTGG No data
Right 1170033677 20:11968234-11968256 CTGGAGACCCTGGTTGGGGAGGG No data
1170033668_1170033675 -8 Left 1170033668 20:11968215-11968237 CCCCAACAGTGAGGAAGAACTGG No data
Right 1170033675 20:11968230-11968252 AGAACTGGAGACCCTGGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170033668 Original CRISPR CCAGTTCTTCCTCACTGTTG GGG (reversed) Intergenic
No off target data available for this crispr