ID: 1170036242

View in Genome Browser
Species Human (GRCh38)
Location 20:11993124-11993146
Sequence CTGGGCTGTCAGCACCAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170036232_1170036242 20 Left 1170036232 20:11993081-11993103 CCAACGCTTCTGCCCGGGACATG No data
Right 1170036242 20:11993124-11993146 CTGGGCTGTCAGCACCAGGTAGG No data
1170036228_1170036242 26 Left 1170036228 20:11993075-11993097 CCGAGCCCAACGCTTCTGCCCGG No data
Right 1170036242 20:11993124-11993146 CTGGGCTGTCAGCACCAGGTAGG No data
1170036227_1170036242 27 Left 1170036227 20:11993074-11993096 CCCGAGCCCAACGCTTCTGCCCG No data
Right 1170036242 20:11993124-11993146 CTGGGCTGTCAGCACCAGGTAGG No data
1170036235_1170036242 8 Left 1170036235 20:11993093-11993115 CCCGGGACATGGAGGACCTAGAC No data
Right 1170036242 20:11993124-11993146 CTGGGCTGTCAGCACCAGGTAGG No data
1170036231_1170036242 21 Left 1170036231 20:11993080-11993102 CCCAACGCTTCTGCCCGGGACAT No data
Right 1170036242 20:11993124-11993146 CTGGGCTGTCAGCACCAGGTAGG No data
1170036236_1170036242 7 Left 1170036236 20:11993094-11993116 CCGGGACATGGAGGACCTAGACG No data
Right 1170036242 20:11993124-11993146 CTGGGCTGTCAGCACCAGGTAGG No data
1170036240_1170036242 -8 Left 1170036240 20:11993109-11993131 CCTAGACGTGCAGGACTGGGCTG No data
Right 1170036242 20:11993124-11993146 CTGGGCTGTCAGCACCAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170036242 Original CRISPR CTGGGCTGTCAGCACCAGGT AGG Intergenic