ID: 1170039037

View in Genome Browser
Species Human (GRCh38)
Location 20:12020727-12020749
Sequence GGGTGGATTAATCTAAATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170039031_1170039037 25 Left 1170039031 20:12020679-12020701 CCACTCTGTTGTCAAGAACTGGC No data
Right 1170039037 20:12020727-12020749 GGGTGGATTAATCTAAATAGGGG No data
1170039029_1170039037 26 Left 1170039029 20:12020678-12020700 CCCACTCTGTTGTCAAGAACTGG No data
Right 1170039037 20:12020727-12020749 GGGTGGATTAATCTAAATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170039037 Original CRISPR GGGTGGATTAATCTAAATAG GGG Intergenic
No off target data available for this crispr