ID: 1170039523

View in Genome Browser
Species Human (GRCh38)
Location 20:12025423-12025445
Sequence TGTTTACATCTAAACTTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170039523_1170039525 -1 Left 1170039523 20:12025423-12025445 CCTTCTAAGTTTAGATGTAAACA No data
Right 1170039525 20:12025445-12025467 ATGTCAGGAATTACCTCCCCTGG No data
1170039523_1170039526 0 Left 1170039523 20:12025423-12025445 CCTTCTAAGTTTAGATGTAAACA No data
Right 1170039526 20:12025446-12025468 TGTCAGGAATTACCTCCCCTGGG No data
1170039523_1170039532 24 Left 1170039523 20:12025423-12025445 CCTTCTAAGTTTAGATGTAAACA No data
Right 1170039532 20:12025470-12025492 CAAGTGCCCCACATAAATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170039523 Original CRISPR TGTTTACATCTAAACTTAGA AGG (reversed) Intergenic
No off target data available for this crispr