ID: 1170039532

View in Genome Browser
Species Human (GRCh38)
Location 20:12025470-12025492
Sequence CAAGTGCCCCACATAAATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170039523_1170039532 24 Left 1170039523 20:12025423-12025445 CCTTCTAAGTTTAGATGTAAACA No data
Right 1170039532 20:12025470-12025492 CAAGTGCCCCACATAAATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170039532 Original CRISPR CAAGTGCCCCACATAAATCT TGG Intergenic
No off target data available for this crispr