ID: 1170045655

View in Genome Browser
Species Human (GRCh38)
Location 20:12082739-12082761
Sequence CACATTTATTCCTATGACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170045652_1170045655 22 Left 1170045652 20:12082694-12082716 CCAATCACTTATACAAAACTGAT No data
Right 1170045655 20:12082739-12082761 CACATTTATTCCTATGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170045655 Original CRISPR CACATTTATTCCTATGACCT GGG Intergenic
No off target data available for this crispr