ID: 1170045945

View in Genome Browser
Species Human (GRCh38)
Location 20:12085330-12085352
Sequence TTCCCAAGATTGCTGGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170045934_1170045945 29 Left 1170045934 20:12085278-12085300 CCATCTCCAAATGCAGAGGCACA No data
Right 1170045945 20:12085330-12085352 TTCCCAAGATTGCTGGAGAGTGG No data
1170045943_1170045945 -9 Left 1170045943 20:12085316-12085338 CCAGGGCTGAGGGGTTCCCAAGA No data
Right 1170045945 20:12085330-12085352 TTCCCAAGATTGCTGGAGAGTGG No data
1170045935_1170045945 23 Left 1170045935 20:12085284-12085306 CCAAATGCAGAGGCACAGTCAGT No data
Right 1170045945 20:12085330-12085352 TTCCCAAGATTGCTGGAGAGTGG No data
1170045941_1170045945 -7 Left 1170045941 20:12085314-12085336 CCCCAGGGCTGAGGGGTTCCCAA No data
Right 1170045945 20:12085330-12085352 TTCCCAAGATTGCTGGAGAGTGG No data
1170045942_1170045945 -8 Left 1170045942 20:12085315-12085337 CCCAGGGCTGAGGGGTTCCCAAG No data
Right 1170045945 20:12085330-12085352 TTCCCAAGATTGCTGGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170045945 Original CRISPR TTCCCAAGATTGCTGGAGAG TGG Intergenic
No off target data available for this crispr