ID: 1170049141

View in Genome Browser
Species Human (GRCh38)
Location 20:12122386-12122408
Sequence CTCTGTTATCAGCAATGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170049141_1170049144 9 Left 1170049141 20:12122386-12122408 CCCATGCATTGCTGATAACAGAG No data
Right 1170049144 20:12122418-12122440 AAACTGCTTTGGAAAATACTTGG No data
1170049141_1170049143 -2 Left 1170049141 20:12122386-12122408 CCCATGCATTGCTGATAACAGAG No data
Right 1170049143 20:12122407-12122429 AGATACTGATAAAACTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170049141 Original CRISPR CTCTGTTATCAGCAATGCAT GGG (reversed) Intergenic
No off target data available for this crispr