ID: 1170054124

View in Genome Browser
Species Human (GRCh38)
Location 20:12180299-12180321
Sequence CTCCCTGAGAACGTGAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170054124_1170054126 0 Left 1170054124 20:12180299-12180321 CCTGGGTTCACGTTCTCAGGGAG No data
Right 1170054126 20:12180322-12180344 AAAATTGGATGCACAAAGAATGG No data
1170054124_1170054127 13 Left 1170054124 20:12180299-12180321 CCTGGGTTCACGTTCTCAGGGAG No data
Right 1170054127 20:12180335-12180357 CAAAGAATGGAGTTTGCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170054124 Original CRISPR CTCCCTGAGAACGTGAACCC AGG (reversed) Intergenic
No off target data available for this crispr