ID: 1170054126

View in Genome Browser
Species Human (GRCh38)
Location 20:12180322-12180344
Sequence AAAATTGGATGCACAAAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170054119_1170054126 7 Left 1170054119 20:12180292-12180314 CCACTCCCCTGGGTTCACGTTCT No data
Right 1170054126 20:12180322-12180344 AAAATTGGATGCACAAAGAATGG No data
1170054124_1170054126 0 Left 1170054124 20:12180299-12180321 CCTGGGTTCACGTTCTCAGGGAG No data
Right 1170054126 20:12180322-12180344 AAAATTGGATGCACAAAGAATGG No data
1170054123_1170054126 1 Left 1170054123 20:12180298-12180320 CCCTGGGTTCACGTTCTCAGGGA No data
Right 1170054126 20:12180322-12180344 AAAATTGGATGCACAAAGAATGG No data
1170054121_1170054126 2 Left 1170054121 20:12180297-12180319 CCCCTGGGTTCACGTTCTCAGGG No data
Right 1170054126 20:12180322-12180344 AAAATTGGATGCACAAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170054126 Original CRISPR AAAATTGGATGCACAAAGAA TGG Intergenic
No off target data available for this crispr