ID: 1170058827

View in Genome Browser
Species Human (GRCh38)
Location 20:12237985-12238007
Sequence GTCAGTGTCAAATTGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170058821_1170058827 22 Left 1170058821 20:12237940-12237962 CCAGCTTTCCTCGTAGGGAGGGG No data
Right 1170058827 20:12237985-12238007 GTCAGTGTCAAATTGGTGGAAGG No data
1170058823_1170058827 14 Left 1170058823 20:12237948-12237970 CCTCGTAGGGAGGGGAAGTTTAG No data
Right 1170058827 20:12237985-12238007 GTCAGTGTCAAATTGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170058827 Original CRISPR GTCAGTGTCAAATTGGTGGA AGG Intergenic
No off target data available for this crispr