ID: 1170060172

View in Genome Browser
Species Human (GRCh38)
Location 20:12250634-12250656
Sequence GTCCCAAGAAAACCAACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170060172_1170060177 10 Left 1170060172 20:12250634-12250656 CCATCAGTTGGTTTTCTTGGGAC No data
Right 1170060177 20:12250667-12250689 CCCACCTTCCATCCTCCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170060172 Original CRISPR GTCCCAAGAAAACCAACTGA TGG (reversed) Intergenic
No off target data available for this crispr