ID: 1170060177

View in Genome Browser
Species Human (GRCh38)
Location 20:12250667-12250689
Sequence CCCACCTTCCATCCTCCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170060167_1170060177 30 Left 1170060167 20:12250614-12250636 CCAGGTATTAAGCTTAGTACCCA 0: 39
1: 827
2: 2077
3: 3164
4: 3523
Right 1170060177 20:12250667-12250689 CCCACCTTCCATCCTCCAAAAGG No data
1170060172_1170060177 10 Left 1170060172 20:12250634-12250656 CCATCAGTTGGTTTTCTTGGGAC No data
Right 1170060177 20:12250667-12250689 CCCACCTTCCATCCTCCAAAAGG No data
1170060171_1170060177 11 Left 1170060171 20:12250633-12250655 CCCATCAGTTGGTTTTCTTGGGA No data
Right 1170060177 20:12250667-12250689 CCCACCTTCCATCCTCCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170060177 Original CRISPR CCCACCTTCCATCCTCCAAA AGG Intergenic
No off target data available for this crispr