ID: 1170064437

View in Genome Browser
Species Human (GRCh38)
Location 20:12295225-12295247
Sequence GTCTCAAAGGTATTAATAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170064437_1170064443 22 Left 1170064437 20:12295225-12295247 CCTGCTATTAATACCTTTGAGAC No data
Right 1170064443 20:12295270-12295292 TGGACATAATTCAGAGGACAAGG No data
1170064437_1170064441 16 Left 1170064437 20:12295225-12295247 CCTGCTATTAATACCTTTGAGAC No data
Right 1170064441 20:12295264-12295286 AGTACCTGGACATAATTCAGAGG No data
1170064437_1170064439 2 Left 1170064437 20:12295225-12295247 CCTGCTATTAATACCTTTGAGAC No data
Right 1170064439 20:12295250-12295272 TAATTTCACCAGAGAGTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170064437 Original CRISPR GTCTCAAAGGTATTAATAGC AGG (reversed) Intergenic
No off target data available for this crispr