ID: 1170064703

View in Genome Browser
Species Human (GRCh38)
Location 20:12298876-12298898
Sequence CAACATTCACATAAACTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170064703_1170064708 -1 Left 1170064703 20:12298876-12298898 CCAAGCAGTTTATGTGAATGTTG No data
Right 1170064708 20:12298898-12298920 GGTGGTATGTGCAATGGCCTGGG No data
1170064703_1170064712 22 Left 1170064703 20:12298876-12298898 CCAAGCAGTTTATGTGAATGTTG No data
Right 1170064712 20:12298921-12298943 CAGGCCGGTTCCCAGACTTCAGG No data
1170064703_1170064710 7 Left 1170064703 20:12298876-12298898 CCAAGCAGTTTATGTGAATGTTG No data
Right 1170064710 20:12298906-12298928 GTGCAATGGCCTGGGCAGGCCGG No data
1170064703_1170064706 -7 Left 1170064703 20:12298876-12298898 CCAAGCAGTTTATGTGAATGTTG No data
Right 1170064706 20:12298892-12298914 AATGTTGGTGGTATGTGCAATGG No data
1170064703_1170064713 25 Left 1170064703 20:12298876-12298898 CCAAGCAGTTTATGTGAATGTTG No data
Right 1170064713 20:12298924-12298946 GCCGGTTCCCAGACTTCAGGTGG No data
1170064703_1170064707 -2 Left 1170064703 20:12298876-12298898 CCAAGCAGTTTATGTGAATGTTG No data
Right 1170064707 20:12298897-12298919 TGGTGGTATGTGCAATGGCCTGG No data
1170064703_1170064709 3 Left 1170064703 20:12298876-12298898 CCAAGCAGTTTATGTGAATGTTG No data
Right 1170064709 20:12298902-12298924 GTATGTGCAATGGCCTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170064703 Original CRISPR CAACATTCACATAAACTGCT TGG (reversed) Intergenic