ID: 1170064713

View in Genome Browser
Species Human (GRCh38)
Location 20:12298924-12298946
Sequence GCCGGTTCCCAGACTTCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170064703_1170064713 25 Left 1170064703 20:12298876-12298898 CCAAGCAGTTTATGTGAATGTTG No data
Right 1170064713 20:12298924-12298946 GCCGGTTCCCAGACTTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170064713 Original CRISPR GCCGGTTCCCAGACTTCAGG TGG Intergenic
No off target data available for this crispr