ID: 1170065479

View in Genome Browser
Species Human (GRCh38)
Location 20:12305529-12305551
Sequence TTGTGGCAATGTAGCATCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170065479_1170065482 25 Left 1170065479 20:12305529-12305551 CCCTTGATGCTACATTGCCACAA No data
Right 1170065482 20:12305577-12305599 TCCTTTTGTTTGTGATAAACAGG No data
1170065479_1170065484 28 Left 1170065479 20:12305529-12305551 CCCTTGATGCTACATTGCCACAA No data
Right 1170065484 20:12305580-12305602 TTTTGTTTGTGATAAACAGGAGG No data
1170065479_1170065485 29 Left 1170065479 20:12305529-12305551 CCCTTGATGCTACATTGCCACAA No data
Right 1170065485 20:12305581-12305603 TTTGTTTGTGATAAACAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170065479 Original CRISPR TTGTGGCAATGTAGCATCAA GGG (reversed) Intergenic
No off target data available for this crispr