ID: 1170065484

View in Genome Browser
Species Human (GRCh38)
Location 20:12305580-12305602
Sequence TTTTGTTTGTGATAAACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170065481_1170065484 11 Left 1170065481 20:12305546-12305568 CCACAAAAGAAGAAAGAAAAAGA No data
Right 1170065484 20:12305580-12305602 TTTTGTTTGTGATAAACAGGAGG No data
1170065480_1170065484 27 Left 1170065480 20:12305530-12305552 CCTTGATGCTACATTGCCACAAA No data
Right 1170065484 20:12305580-12305602 TTTTGTTTGTGATAAACAGGAGG No data
1170065479_1170065484 28 Left 1170065479 20:12305529-12305551 CCCTTGATGCTACATTGCCACAA No data
Right 1170065484 20:12305580-12305602 TTTTGTTTGTGATAAACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170065484 Original CRISPR TTTTGTTTGTGATAAACAGG AGG Intergenic
No off target data available for this crispr