ID: 1170065828

View in Genome Browser
Species Human (GRCh38)
Location 20:12309424-12309446
Sequence TTCGAAGGAATCCCTAAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170065828_1170065831 -2 Left 1170065828 20:12309424-12309446 CCTCATTTAGGGATTCCTTCGAA No data
Right 1170065831 20:12309445-12309467 AATCCTTCAGGACTAGATTGAGG No data
1170065828_1170065834 29 Left 1170065828 20:12309424-12309446 CCTCATTTAGGGATTCCTTCGAA No data
Right 1170065834 20:12309476-12309498 TCTCATCTAGAATATTGCATGGG No data
1170065828_1170065833 28 Left 1170065828 20:12309424-12309446 CCTCATTTAGGGATTCCTTCGAA No data
Right 1170065833 20:12309475-12309497 TTCTCATCTAGAATATTGCATGG No data
1170065828_1170065835 30 Left 1170065828 20:12309424-12309446 CCTCATTTAGGGATTCCTTCGAA No data
Right 1170065835 20:12309477-12309499 CTCATCTAGAATATTGCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170065828 Original CRISPR TTCGAAGGAATCCCTAAATG AGG (reversed) Intergenic