ID: 1170065830

View in Genome Browser
Species Human (GRCh38)
Location 20:12309439-12309461
Sequence TCTAGTCCTGAAGGATTCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170065830_1170065834 14 Left 1170065830 20:12309439-12309461 CCTTCGAATCCTTCAGGACTAGA No data
Right 1170065834 20:12309476-12309498 TCTCATCTAGAATATTGCATGGG No data
1170065830_1170065833 13 Left 1170065830 20:12309439-12309461 CCTTCGAATCCTTCAGGACTAGA No data
Right 1170065833 20:12309475-12309497 TTCTCATCTAGAATATTGCATGG No data
1170065830_1170065836 16 Left 1170065830 20:12309439-12309461 CCTTCGAATCCTTCAGGACTAGA No data
Right 1170065836 20:12309478-12309500 TCATCTAGAATATTGCATGGGGG No data
1170065830_1170065835 15 Left 1170065830 20:12309439-12309461 CCTTCGAATCCTTCAGGACTAGA No data
Right 1170065835 20:12309477-12309499 CTCATCTAGAATATTGCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170065830 Original CRISPR TCTAGTCCTGAAGGATTCGA AGG (reversed) Intergenic