ID: 1170065832

View in Genome Browser
Species Human (GRCh38)
Location 20:12309448-12309470
Sequence CAACCTCAATCTAGTCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170065832_1170065834 5 Left 1170065832 20:12309448-12309470 CCTTCAGGACTAGATTGAGGTTG No data
Right 1170065834 20:12309476-12309498 TCTCATCTAGAATATTGCATGGG No data
1170065832_1170065835 6 Left 1170065832 20:12309448-12309470 CCTTCAGGACTAGATTGAGGTTG No data
Right 1170065835 20:12309477-12309499 CTCATCTAGAATATTGCATGGGG No data
1170065832_1170065833 4 Left 1170065832 20:12309448-12309470 CCTTCAGGACTAGATTGAGGTTG No data
Right 1170065833 20:12309475-12309497 TTCTCATCTAGAATATTGCATGG No data
1170065832_1170065836 7 Left 1170065832 20:12309448-12309470 CCTTCAGGACTAGATTGAGGTTG No data
Right 1170065836 20:12309478-12309500 TCATCTAGAATATTGCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170065832 Original CRISPR CAACCTCAATCTAGTCCTGA AGG (reversed) Intergenic
No off target data available for this crispr