ID: 1170065835

View in Genome Browser
Species Human (GRCh38)
Location 20:12309477-12309499
Sequence CTCATCTAGAATATTGCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170065830_1170065835 15 Left 1170065830 20:12309439-12309461 CCTTCGAATCCTTCAGGACTAGA No data
Right 1170065835 20:12309477-12309499 CTCATCTAGAATATTGCATGGGG No data
1170065828_1170065835 30 Left 1170065828 20:12309424-12309446 CCTCATTTAGGGATTCCTTCGAA No data
Right 1170065835 20:12309477-12309499 CTCATCTAGAATATTGCATGGGG No data
1170065832_1170065835 6 Left 1170065832 20:12309448-12309470 CCTTCAGGACTAGATTGAGGTTG No data
Right 1170065835 20:12309477-12309499 CTCATCTAGAATATTGCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170065835 Original CRISPR CTCATCTAGAATATTGCATG GGG Intergenic