ID: 1170065835 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:12309477-12309499 |
Sequence | CTCATCTAGAATATTGCATG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1170065830_1170065835 | 15 | Left | 1170065830 | 20:12309439-12309461 | CCTTCGAATCCTTCAGGACTAGA | No data | ||
Right | 1170065835 | 20:12309477-12309499 | CTCATCTAGAATATTGCATGGGG | No data | ||||
1170065828_1170065835 | 30 | Left | 1170065828 | 20:12309424-12309446 | CCTCATTTAGGGATTCCTTCGAA | No data | ||
Right | 1170065835 | 20:12309477-12309499 | CTCATCTAGAATATTGCATGGGG | No data | ||||
1170065832_1170065835 | 6 | Left | 1170065832 | 20:12309448-12309470 | CCTTCAGGACTAGATTGAGGTTG | No data | ||
Right | 1170065835 | 20:12309477-12309499 | CTCATCTAGAATATTGCATGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1170065835 | Original CRISPR | CTCATCTAGAATATTGCATG GGG | Intergenic | ||