ID: 1170065836

View in Genome Browser
Species Human (GRCh38)
Location 20:12309478-12309500
Sequence TCATCTAGAATATTGCATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170065832_1170065836 7 Left 1170065832 20:12309448-12309470 CCTTCAGGACTAGATTGAGGTTG No data
Right 1170065836 20:12309478-12309500 TCATCTAGAATATTGCATGGGGG No data
1170065830_1170065836 16 Left 1170065830 20:12309439-12309461 CCTTCGAATCCTTCAGGACTAGA No data
Right 1170065836 20:12309478-12309500 TCATCTAGAATATTGCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170065836 Original CRISPR TCATCTAGAATATTGCATGG GGG Intergenic