ID: 1170065836 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:12309478-12309500 |
| Sequence | TCATCTAGAATATTGCATGG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1170065832_1170065836 | 7 | Left | 1170065832 | 20:12309448-12309470 | CCTTCAGGACTAGATTGAGGTTG | No data | ||
| Right | 1170065836 | 20:12309478-12309500 | TCATCTAGAATATTGCATGGGGG | No data | ||||
| 1170065830_1170065836 | 16 | Left | 1170065830 | 20:12309439-12309461 | CCTTCGAATCCTTCAGGACTAGA | No data | ||
| Right | 1170065836 | 20:12309478-12309500 | TCATCTAGAATATTGCATGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1170065836 | Original CRISPR | TCATCTAGAATATTGCATGG GGG | Intergenic | ||