ID: 1170069063

View in Genome Browser
Species Human (GRCh38)
Location 20:12344972-12344994
Sequence GCAAGTCCTGCTTTTCTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170069063_1170069073 0 Left 1170069063 20:12344972-12344994 CCCCCTAGAAAAGCAGGACTTGC No data
Right 1170069073 20:12344995-12345017 CACTAAGGGTGAAGGAGAAGGGG 0: 147
1: 289
2: 224
3: 98
4: 363
1170069063_1170069072 -1 Left 1170069063 20:12344972-12344994 CCCCCTAGAAAAGCAGGACTTGC No data
Right 1170069072 20:12344994-12345016 CCACTAAGGGTGAAGGAGAAGGG 0: 143
1: 304
2: 349
3: 426
4: 493
1170069063_1170069070 -2 Left 1170069063 20:12344972-12344994 CCCCCTAGAAAAGCAGGACTTGC No data
Right 1170069070 20:12344993-12345015 GCCACTAAGGGTGAAGGAGAAGG 0: 148
1: 295
2: 218
3: 88
4: 242
1170069063_1170069075 7 Left 1170069063 20:12344972-12344994 CCCCCTAGAAAAGCAGGACTTGC No data
Right 1170069075 20:12345002-12345024 GGTGAAGGAGAAGGGGTTGAGGG 0: 375
1: 236
2: 100
3: 101
4: 1002
1170069063_1170069069 -8 Left 1170069063 20:12344972-12344994 CCCCCTAGAAAAGCAGGACTTGC No data
Right 1170069069 20:12344987-12345009 GGACTTGCCACTAAGGGTGAAGG 0: 212
1: 594
2: 424
3: 169
4: 131
1170069063_1170069076 8 Left 1170069063 20:12344972-12344994 CCCCCTAGAAAAGCAGGACTTGC No data
Right 1170069076 20:12345003-12345025 GTGAAGGAGAAGGGGTTGAGGGG 0: 407
1: 144
2: 39
3: 71
4: 574
1170069063_1170069074 6 Left 1170069063 20:12344972-12344994 CCCCCTAGAAAAGCAGGACTTGC No data
Right 1170069074 20:12345001-12345023 GGGTGAAGGAGAAGGGGTTGAGG 0: 458
1: 207
2: 56
3: 137
4: 1396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170069063 Original CRISPR GCAAGTCCTGCTTTTCTAGG GGG (reversed) Intergenic
No off target data available for this crispr