ID: 1170069423

View in Genome Browser
Species Human (GRCh38)
Location 20:12348834-12348856
Sequence CATGCCCCTCTCTCATCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170069419_1170069423 23 Left 1170069419 20:12348788-12348810 CCAAGAACTTATGAGGATTGAGC No data
Right 1170069423 20:12348834-12348856 CATGCCCCTCTCTCATCAGCTGG No data
1170069421_1170069423 -9 Left 1170069421 20:12348820-12348842 CCTAGCATGGCTTCCATGCCCCT No data
Right 1170069423 20:12348834-12348856 CATGCCCCTCTCTCATCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170069423 Original CRISPR CATGCCCCTCTCTCATCAGC TGG Intergenic
No off target data available for this crispr