ID: 1170071309

View in Genome Browser
Species Human (GRCh38)
Location 20:12372120-12372142
Sequence TGTTCTCTGAGGAGCACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170071303_1170071309 26 Left 1170071303 20:12372071-12372093 CCTTTGTGTAACTAGGAGCTTTG No data
Right 1170071309 20:12372120-12372142 TGTTCTCTGAGGAGCACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170071309 Original CRISPR TGTTCTCTGAGGAGCACAGC TGG Intergenic
No off target data available for this crispr