ID: 1170071797

View in Genome Browser
Species Human (GRCh38)
Location 20:12377320-12377342
Sequence CCAATCTGTGAGTAATACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170071797_1170071799 -10 Left 1170071797 20:12377320-12377342 CCAGTGTATTACTCACAGATTGG No data
Right 1170071799 20:12377333-12377355 CACAGATTGGTAAGAGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170071797 Original CRISPR CCAATCTGTGAGTAATACAC TGG (reversed) Intergenic
No off target data available for this crispr