ID: 1170075831

View in Genome Browser
Species Human (GRCh38)
Location 20:12417735-12417757
Sequence CAGTGCAGACAGCAGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170075831_1170075837 10 Left 1170075831 20:12417735-12417757 CCCAGCCCCTGCTGTCTGCACTG No data
Right 1170075837 20:12417768-12417790 AAGCGGATGTTCTCTGCTCTTGG No data
1170075831_1170075836 -7 Left 1170075831 20:12417735-12417757 CCCAGCCCCTGCTGTCTGCACTG No data
Right 1170075836 20:12417751-12417773 TGCACTGTAATAGTTATAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170075831 Original CRISPR CAGTGCAGACAGCAGGGGCT GGG (reversed) Intergenic
No off target data available for this crispr