ID: 1170075836

View in Genome Browser
Species Human (GRCh38)
Location 20:12417751-12417773
Sequence TGCACTGTAATAGTTATAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170075827_1170075836 27 Left 1170075827 20:12417701-12417723 CCCAGTGTGGGCTGGTGCTCATG No data
Right 1170075836 20:12417751-12417773 TGCACTGTAATAGTTATAAGCGG No data
1170075826_1170075836 28 Left 1170075826 20:12417700-12417722 CCCCAGTGTGGGCTGGTGCTCAT No data
Right 1170075836 20:12417751-12417773 TGCACTGTAATAGTTATAAGCGG No data
1170075828_1170075836 26 Left 1170075828 20:12417702-12417724 CCAGTGTGGGCTGGTGCTCATGA No data
Right 1170075836 20:12417751-12417773 TGCACTGTAATAGTTATAAGCGG No data
1170075829_1170075836 0 Left 1170075829 20:12417728-12417750 CCTGCTCCCCAGCCCCTGCTGTC No data
Right 1170075836 20:12417751-12417773 TGCACTGTAATAGTTATAAGCGG No data
1170075831_1170075836 -7 Left 1170075831 20:12417735-12417757 CCCAGCCCCTGCTGTCTGCACTG No data
Right 1170075836 20:12417751-12417773 TGCACTGTAATAGTTATAAGCGG No data
1170075832_1170075836 -8 Left 1170075832 20:12417736-12417758 CCAGCCCCTGCTGTCTGCACTGT No data
Right 1170075836 20:12417751-12417773 TGCACTGTAATAGTTATAAGCGG No data
1170075830_1170075836 -6 Left 1170075830 20:12417734-12417756 CCCCAGCCCCTGCTGTCTGCACT No data
Right 1170075836 20:12417751-12417773 TGCACTGTAATAGTTATAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170075836 Original CRISPR TGCACTGTAATAGTTATAAG CGG Intergenic
No off target data available for this crispr