ID: 1170075837

View in Genome Browser
Species Human (GRCh38)
Location 20:12417768-12417790
Sequence AAGCGGATGTTCTCTGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170075829_1170075837 17 Left 1170075829 20:12417728-12417750 CCTGCTCCCCAGCCCCTGCTGTC No data
Right 1170075837 20:12417768-12417790 AAGCGGATGTTCTCTGCTCTTGG No data
1170075832_1170075837 9 Left 1170075832 20:12417736-12417758 CCAGCCCCTGCTGTCTGCACTGT No data
Right 1170075837 20:12417768-12417790 AAGCGGATGTTCTCTGCTCTTGG No data
1170075834_1170075837 4 Left 1170075834 20:12417741-12417763 CCCTGCTGTCTGCACTGTAATAG No data
Right 1170075837 20:12417768-12417790 AAGCGGATGTTCTCTGCTCTTGG No data
1170075835_1170075837 3 Left 1170075835 20:12417742-12417764 CCTGCTGTCTGCACTGTAATAGT No data
Right 1170075837 20:12417768-12417790 AAGCGGATGTTCTCTGCTCTTGG No data
1170075830_1170075837 11 Left 1170075830 20:12417734-12417756 CCCCAGCCCCTGCTGTCTGCACT No data
Right 1170075837 20:12417768-12417790 AAGCGGATGTTCTCTGCTCTTGG No data
1170075833_1170075837 5 Left 1170075833 20:12417740-12417762 CCCCTGCTGTCTGCACTGTAATA No data
Right 1170075837 20:12417768-12417790 AAGCGGATGTTCTCTGCTCTTGG No data
1170075831_1170075837 10 Left 1170075831 20:12417735-12417757 CCCAGCCCCTGCTGTCTGCACTG No data
Right 1170075837 20:12417768-12417790 AAGCGGATGTTCTCTGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170075837 Original CRISPR AAGCGGATGTTCTCTGCTCT TGG Intergenic
No off target data available for this crispr