ID: 1170077611

View in Genome Browser
Species Human (GRCh38)
Location 20:12436932-12436954
Sequence AAATGGTTGGTAAATTCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170077603_1170077611 14 Left 1170077603 20:12436895-12436917 CCTCCTATAATTCACAATTTACT No data
Right 1170077611 20:12436932-12436954 AAATGGTTGGTAAATTCTGATGG No data
1170077602_1170077611 15 Left 1170077602 20:12436894-12436916 CCCTCCTATAATTCACAATTTAC No data
Right 1170077611 20:12436932-12436954 AAATGGTTGGTAAATTCTGATGG No data
1170077604_1170077611 11 Left 1170077604 20:12436898-12436920 CCTATAATTCACAATTTACTAAA No data
Right 1170077611 20:12436932-12436954 AAATGGTTGGTAAATTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170077611 Original CRISPR AAATGGTTGGTAAATTCTGA TGG Intergenic
No off target data available for this crispr