ID: 1170081625 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:12482928-12482950 |
Sequence | GTTGAGAAGCTTAAAGAGGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1170081623_1170081625 | 5 | Left | 1170081623 | 20:12482900-12482922 | CCAGAAACACAAATGCAATAATA | No data | ||
Right | 1170081625 | 20:12482928-12482950 | GTTGAGAAGCTTAAAGAGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1170081625 | Original CRISPR | GTTGAGAAGCTTAAAGAGGA AGG | Intergenic | ||
No off target data available for this crispr |