ID: 1170081625

View in Genome Browser
Species Human (GRCh38)
Location 20:12482928-12482950
Sequence GTTGAGAAGCTTAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170081623_1170081625 5 Left 1170081623 20:12482900-12482922 CCAGAAACACAAATGCAATAATA No data
Right 1170081625 20:12482928-12482950 GTTGAGAAGCTTAAAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170081625 Original CRISPR GTTGAGAAGCTTAAAGAGGA AGG Intergenic
No off target data available for this crispr