ID: 1170083698

View in Genome Browser
Species Human (GRCh38)
Location 20:12505556-12505578
Sequence CTGTAGCAGTGGAAGTAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170083694_1170083698 1 Left 1170083694 20:12505532-12505554 CCTTGGGATGGCTGAACAGACTC No data
Right 1170083698 20:12505556-12505578 CTGTAGCAGTGGAAGTAGGAGGG No data
1170083692_1170083698 16 Left 1170083692 20:12505517-12505539 CCTGAGATGCATGTACCTTGGGA No data
Right 1170083698 20:12505556-12505578 CTGTAGCAGTGGAAGTAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170083698 Original CRISPR CTGTAGCAGTGGAAGTAGGA GGG Intergenic
No off target data available for this crispr