ID: 1170091508

View in Genome Browser
Species Human (GRCh38)
Location 20:12594140-12594162
Sequence CAAACGGGAGGTTGGATGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170091508_1170091519 25 Left 1170091508 20:12594140-12594162 CCCATCATCCAACCTCCCGTTTG No data
Right 1170091519 20:12594188-12594210 CAGCCTCTGTGGGAGCAGCCAGG No data
1170091508_1170091518 15 Left 1170091508 20:12594140-12594162 CCCATCATCCAACCTCCCGTTTG No data
Right 1170091518 20:12594178-12594200 CCTGCAGATTCAGCCTCTGTGGG No data
1170091508_1170091520 26 Left 1170091508 20:12594140-12594162 CCCATCATCCAACCTCCCGTTTG No data
Right 1170091520 20:12594189-12594211 AGCCTCTGTGGGAGCAGCCAGGG No data
1170091508_1170091516 14 Left 1170091508 20:12594140-12594162 CCCATCATCCAACCTCCCGTTTG No data
Right 1170091516 20:12594177-12594199 TCCTGCAGATTCAGCCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170091508 Original CRISPR CAAACGGGAGGTTGGATGAT GGG (reversed) Intergenic
No off target data available for this crispr