ID: 1170091845

View in Genome Browser
Species Human (GRCh38)
Location 20:12597767-12597789
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170091845_1170091849 25 Left 1170091845 20:12597767-12597789 CCCTAAATGCCAAACAGCTTAGA No data
Right 1170091849 20:12597815-12597837 TCAAAGAGCCTCTGGAACACTGG No data
1170091845_1170091848 17 Left 1170091845 20:12597767-12597789 CCCTAAATGCCAAACAGCTTAGA No data
Right 1170091848 20:12597807-12597829 CGTAAATATCAAAGAGCCTCTGG No data
1170091845_1170091850 26 Left 1170091845 20:12597767-12597789 CCCTAAATGCCAAACAGCTTAGA No data
Right 1170091850 20:12597816-12597838 CAAAGAGCCTCTGGAACACTGGG No data
1170091845_1170091852 28 Left 1170091845 20:12597767-12597789 CCCTAAATGCCAAACAGCTTAGA No data
Right 1170091852 20:12597818-12597840 AAGAGCCTCTGGAACACTGGGGG No data
1170091845_1170091851 27 Left 1170091845 20:12597767-12597789 CCCTAAATGCCAAACAGCTTAGA No data
Right 1170091851 20:12597817-12597839 AAAGAGCCTCTGGAACACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170091845 Original CRISPR TCTAAGCTGTTTGGCATTTA GGG (reversed) Intergenic
No off target data available for this crispr