ID: 1170091847

View in Genome Browser
Species Human (GRCh38)
Location 20:12597776-12597798
Sequence ATCTCTTTCTCTAAGCTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170091847_1170091852 19 Left 1170091847 20:12597776-12597798 CCAAACAGCTTAGAGAAAGAGAT No data
Right 1170091852 20:12597818-12597840 AAGAGCCTCTGGAACACTGGGGG No data
1170091847_1170091851 18 Left 1170091847 20:12597776-12597798 CCAAACAGCTTAGAGAAAGAGAT No data
Right 1170091851 20:12597817-12597839 AAAGAGCCTCTGGAACACTGGGG No data
1170091847_1170091848 8 Left 1170091847 20:12597776-12597798 CCAAACAGCTTAGAGAAAGAGAT No data
Right 1170091848 20:12597807-12597829 CGTAAATATCAAAGAGCCTCTGG No data
1170091847_1170091850 17 Left 1170091847 20:12597776-12597798 CCAAACAGCTTAGAGAAAGAGAT No data
Right 1170091850 20:12597816-12597838 CAAAGAGCCTCTGGAACACTGGG No data
1170091847_1170091853 23 Left 1170091847 20:12597776-12597798 CCAAACAGCTTAGAGAAAGAGAT No data
Right 1170091853 20:12597822-12597844 GCCTCTGGAACACTGGGGGCAGG No data
1170091847_1170091849 16 Left 1170091847 20:12597776-12597798 CCAAACAGCTTAGAGAAAGAGAT No data
Right 1170091849 20:12597815-12597837 TCAAAGAGCCTCTGGAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170091847 Original CRISPR ATCTCTTTCTCTAAGCTGTT TGG (reversed) Intergenic
No off target data available for this crispr