ID: 1170091852

View in Genome Browser
Species Human (GRCh38)
Location 20:12597818-12597840
Sequence AAGAGCCTCTGGAACACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170091846_1170091852 27 Left 1170091846 20:12597768-12597790 CCTAAATGCCAAACAGCTTAGAG No data
Right 1170091852 20:12597818-12597840 AAGAGCCTCTGGAACACTGGGGG No data
1170091847_1170091852 19 Left 1170091847 20:12597776-12597798 CCAAACAGCTTAGAGAAAGAGAT No data
Right 1170091852 20:12597818-12597840 AAGAGCCTCTGGAACACTGGGGG No data
1170091845_1170091852 28 Left 1170091845 20:12597767-12597789 CCCTAAATGCCAAACAGCTTAGA No data
Right 1170091852 20:12597818-12597840 AAGAGCCTCTGGAACACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170091852 Original CRISPR AAGAGCCTCTGGAACACTGG GGG Intergenic
No off target data available for this crispr