ID: 1170092312

View in Genome Browser
Species Human (GRCh38)
Location 20:12604140-12604162
Sequence AGGTATCTGCAGAGGATGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170092310_1170092312 -6 Left 1170092310 20:12604123-12604145 CCTCTCAAAAGCAGAGTAGGTAT No data
Right 1170092312 20:12604140-12604162 AGGTATCTGCAGAGGATGACAGG No data
1170092308_1170092312 -2 Left 1170092308 20:12604119-12604141 CCTGCCTCTCAAAAGCAGAGTAG No data
Right 1170092312 20:12604140-12604162 AGGTATCTGCAGAGGATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170092312 Original CRISPR AGGTATCTGCAGAGGATGAC AGG Intergenic
No off target data available for this crispr