ID: 1170092399

View in Genome Browser
Species Human (GRCh38)
Location 20:12604889-12604911
Sequence TGTACTTGGTACATAGCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170092399_1170092401 19 Left 1170092399 20:12604889-12604911 CCAATAGCTATGTACCAAGTACA No data
Right 1170092401 20:12604931-12604953 TCAAACAGTGAAACCATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170092399 Original CRISPR TGTACTTGGTACATAGCTAT TGG (reversed) Intergenic
No off target data available for this crispr