ID: 1170094434

View in Genome Browser
Species Human (GRCh38)
Location 20:12630255-12630277
Sequence AACAATCATCTCAAAATTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170094432_1170094434 -5 Left 1170094432 20:12630237-12630259 CCGTGATGAGTCTGTGTAAACAA No data
Right 1170094434 20:12630255-12630277 AACAATCATCTCAAAATTCTGGG No data
1170094431_1170094434 23 Left 1170094431 20:12630209-12630231 CCTGATTTTCAGTATCAGTCAGT No data
Right 1170094434 20:12630255-12630277 AACAATCATCTCAAAATTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170094434 Original CRISPR AACAATCATCTCAAAATTCT GGG Intergenic
No off target data available for this crispr