ID: 1170095241

View in Genome Browser
Species Human (GRCh38)
Location 20:12638916-12638938
Sequence GACTCTAATGTGATCACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170095239_1170095241 3 Left 1170095239 20:12638890-12638912 CCTTGACTGCTTGGAGATGGAGG No data
Right 1170095241 20:12638916-12638938 GACTCTAATGTGATCACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170095241 Original CRISPR GACTCTAATGTGATCACTGC TGG Intergenic
No off target data available for this crispr