ID: 1170096971

View in Genome Browser
Species Human (GRCh38)
Location 20:12656661-12656683
Sequence CGGGGAGTTTCTCCATATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170096967_1170096971 -9 Left 1170096967 20:12656647-12656669 CCTGGGCTCCTTCCCGGGGAGTT No data
Right 1170096971 20:12656661-12656683 CGGGGAGTTTCTCCATATCATGG No data
1170096959_1170096971 15 Left 1170096959 20:12656623-12656645 CCTCTCTCTCCACATGGCCTTTC No data
Right 1170096971 20:12656661-12656683 CGGGGAGTTTCTCCATATCATGG No data
1170096963_1170096971 -2 Left 1170096963 20:12656640-12656662 CCTTTCACCTGGGCTCCTTCCCG No data
Right 1170096971 20:12656661-12656683 CGGGGAGTTTCTCCATATCATGG No data
1170096962_1170096971 6 Left 1170096962 20:12656632-12656654 CCACATGGCCTTTCACCTGGGCT No data
Right 1170096971 20:12656661-12656683 CGGGGAGTTTCTCCATATCATGG No data
1170096957_1170096971 30 Left 1170096957 20:12656608-12656630 CCTGGAATGGCTGGACCTCTCTC No data
Right 1170096971 20:12656661-12656683 CGGGGAGTTTCTCCATATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170096971 Original CRISPR CGGGGAGTTTCTCCATATCA TGG Intergenic
No off target data available for this crispr