ID: 1170098273

View in Genome Browser
Species Human (GRCh38)
Location 20:12670890-12670912
Sequence TTGGATAACCCCCAAGATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170098266_1170098273 28 Left 1170098266 20:12670839-12670861 CCAGTTCTGCCTTCACCTGAAAA No data
Right 1170098273 20:12670890-12670912 TTGGATAACCCCCAAGATCTGGG No data
1170098267_1170098273 19 Left 1170098267 20:12670848-12670870 CCTTCACCTGAAAAGACAAAGCC No data
Right 1170098273 20:12670890-12670912 TTGGATAACCCCCAAGATCTGGG No data
1170098268_1170098273 13 Left 1170098268 20:12670854-12670876 CCTGAAAAGACAAAGCCAAAAAC No data
Right 1170098273 20:12670890-12670912 TTGGATAACCCCCAAGATCTGGG No data
1170098269_1170098273 -2 Left 1170098269 20:12670869-12670891 CCAAAAACATCCTTGATTTAATT No data
Right 1170098273 20:12670890-12670912 TTGGATAACCCCCAAGATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170098273 Original CRISPR TTGGATAACCCCCAAGATCT GGG Intergenic
No off target data available for this crispr