ID: 1170101382

View in Genome Browser
Species Human (GRCh38)
Location 20:12703451-12703473
Sequence ACATAGACACCATACTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170101382_1170101384 28 Left 1170101382 20:12703451-12703473 CCACCACAGTATGGTGTCTATGT No data
Right 1170101384 20:12703502-12703524 ACTCTACTCCACTCAAAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170101382 Original CRISPR ACATAGACACCATACTGTGG TGG (reversed) Intergenic
No off target data available for this crispr