ID: 1170102687

View in Genome Browser
Species Human (GRCh38)
Location 20:12719944-12719966
Sequence TCAACTCAGTCCATAGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170102687_1170102694 30 Left 1170102687 20:12719944-12719966 CCCTGTGCTATGGACTGAGTTGA No data
Right 1170102694 20:12719997-12720019 ACCCCCAAGGTGGTCACATTGGG No data
1170102687_1170102692 20 Left 1170102687 20:12719944-12719966 CCCTGTGCTATGGACTGAGTTGA No data
Right 1170102692 20:12719987-12720009 TGAAGCTCTAACCCCCAAGGTGG No data
1170102687_1170102691 17 Left 1170102687 20:12719944-12719966 CCCTGTGCTATGGACTGAGTTGA No data
Right 1170102691 20:12719984-12720006 CGTTGAAGCTCTAACCCCCAAGG No data
1170102687_1170102693 29 Left 1170102687 20:12719944-12719966 CCCTGTGCTATGGACTGAGTTGA No data
Right 1170102693 20:12719996-12720018 AACCCCCAAGGTGGTCACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170102687 Original CRISPR TCAACTCAGTCCATAGCACA GGG (reversed) Intergenic
No off target data available for this crispr