ID: 1170102690

View in Genome Browser
Species Human (GRCh38)
Location 20:12719972-12719994
Sequence GAGCTTCAACGTGTAAATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170102690_1170102701 10 Left 1170102690 20:12719972-12719994 CCAAAATTTACACGTTGAAGCTC No data
Right 1170102701 20:12720005-12720027 GGTGGTCACATTGGGATGGGAGG No data
1170102690_1170102699 6 Left 1170102690 20:12719972-12719994 CCAAAATTTACACGTTGAAGCTC No data
Right 1170102699 20:12720001-12720023 CCAAGGTGGTCACATTGGGATGG No data
1170102690_1170102700 7 Left 1170102690 20:12719972-12719994 CCAAAATTTACACGTTGAAGCTC No data
Right 1170102700 20:12720002-12720024 CAAGGTGGTCACATTGGGATGGG No data
1170102690_1170102692 -8 Left 1170102690 20:12719972-12719994 CCAAAATTTACACGTTGAAGCTC No data
Right 1170102692 20:12719987-12720009 TGAAGCTCTAACCCCCAAGGTGG No data
1170102690_1170102694 2 Left 1170102690 20:12719972-12719994 CCAAAATTTACACGTTGAAGCTC No data
Right 1170102694 20:12719997-12720019 ACCCCCAAGGTGGTCACATTGGG No data
1170102690_1170102702 18 Left 1170102690 20:12719972-12719994 CCAAAATTTACACGTTGAAGCTC No data
Right 1170102702 20:12720013-12720035 CATTGGGATGGGAGGTAATTAGG No data
1170102690_1170102693 1 Left 1170102690 20:12719972-12719994 CCAAAATTTACACGTTGAAGCTC No data
Right 1170102693 20:12719996-12720018 AACCCCCAAGGTGGTCACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170102690 Original CRISPR GAGCTTCAACGTGTAAATTT TGG (reversed) Intergenic
No off target data available for this crispr