ID: 1170102691

View in Genome Browser
Species Human (GRCh38)
Location 20:12719984-12720006
Sequence CGTTGAAGCTCTAACCCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170102687_1170102691 17 Left 1170102687 20:12719944-12719966 CCCTGTGCTATGGACTGAGTTGA No data
Right 1170102691 20:12719984-12720006 CGTTGAAGCTCTAACCCCCAAGG No data
1170102686_1170102691 18 Left 1170102686 20:12719943-12719965 CCCCTGTGCTATGGACTGAGTTG No data
Right 1170102691 20:12719984-12720006 CGTTGAAGCTCTAACCCCCAAGG No data
1170102688_1170102691 16 Left 1170102688 20:12719945-12719967 CCTGTGCTATGGACTGAGTTGAG No data
Right 1170102691 20:12719984-12720006 CGTTGAAGCTCTAACCCCCAAGG No data
1170102689_1170102691 -10 Left 1170102689 20:12719971-12719993 CCCAAAATTTACACGTTGAAGCT No data
Right 1170102691 20:12719984-12720006 CGTTGAAGCTCTAACCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170102691 Original CRISPR CGTTGAAGCTCTAACCCCCA AGG Intergenic
No off target data available for this crispr