ID: 1170102694

View in Genome Browser
Species Human (GRCh38)
Location 20:12719997-12720019
Sequence ACCCCCAAGGTGGTCACATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170102690_1170102694 2 Left 1170102690 20:12719972-12719994 CCAAAATTTACACGTTGAAGCTC No data
Right 1170102694 20:12719997-12720019 ACCCCCAAGGTGGTCACATTGGG No data
1170102688_1170102694 29 Left 1170102688 20:12719945-12719967 CCTGTGCTATGGACTGAGTTGAG No data
Right 1170102694 20:12719997-12720019 ACCCCCAAGGTGGTCACATTGGG No data
1170102689_1170102694 3 Left 1170102689 20:12719971-12719993 CCCAAAATTTACACGTTGAAGCT No data
Right 1170102694 20:12719997-12720019 ACCCCCAAGGTGGTCACATTGGG No data
1170102687_1170102694 30 Left 1170102687 20:12719944-12719966 CCCTGTGCTATGGACTGAGTTGA No data
Right 1170102694 20:12719997-12720019 ACCCCCAAGGTGGTCACATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170102694 Original CRISPR ACCCCCAAGGTGGTCACATT GGG Intergenic
No off target data available for this crispr