ID: 1170102696

View in Genome Browser
Species Human (GRCh38)
Location 20:12719999-12720021
Sequence ATCCCAATGTGACCACCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170102696_1170102705 11 Left 1170102696 20:12719999-12720021 CCCCAAGGTGGTCACATTGGGAT No data
Right 1170102705 20:12720033-12720055 AGGTTTAGATGTAATGGGAGTGG No data
1170102696_1170102703 5 Left 1170102696 20:12719999-12720021 CCCCAAGGTGGTCACATTGGGAT No data
Right 1170102703 20:12720027-12720049 GTAATTAGGTTTAGATGTAATGG No data
1170102696_1170102702 -9 Left 1170102696 20:12719999-12720021 CCCCAAGGTGGTCACATTGGGAT No data
Right 1170102702 20:12720013-12720035 CATTGGGATGGGAGGTAATTAGG No data
1170102696_1170102706 12 Left 1170102696 20:12719999-12720021 CCCCAAGGTGGTCACATTGGGAT No data
Right 1170102706 20:12720034-12720056 GGTTTAGATGTAATGGGAGTGGG No data
1170102696_1170102708 25 Left 1170102696 20:12719999-12720021 CCCCAAGGTGGTCACATTGGGAT No data
Right 1170102708 20:12720047-12720069 TGGGAGTGGGGTCCTCGTGCTGG No data
1170102696_1170102704 6 Left 1170102696 20:12719999-12720021 CCCCAAGGTGGTCACATTGGGAT No data
Right 1170102704 20:12720028-12720050 TAATTAGGTTTAGATGTAATGGG No data
1170102696_1170102709 26 Left 1170102696 20:12719999-12720021 CCCCAAGGTGGTCACATTGGGAT No data
Right 1170102709 20:12720048-12720070 GGGAGTGGGGTCCTCGTGCTGGG No data
1170102696_1170102707 13 Left 1170102696 20:12719999-12720021 CCCCAAGGTGGTCACATTGGGAT No data
Right 1170102707 20:12720035-12720057 GTTTAGATGTAATGGGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170102696 Original CRISPR ATCCCAATGTGACCACCTTG GGG (reversed) Intergenic
No off target data available for this crispr